Review



srf d71a9 xp rabbit mab  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc srf d71a9 xp rabbit mab
    Srf D71a9 Xp Rabbit Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 150 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/bio_rxiv__64898__2026__01__13__699089-207-19-25
    Average 94 stars, based on 150 article reviews
    srf d71a9 xp rabbit mab - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Immunoprecipitation:

    Article Title: Ionic Regulation of Mechanosurveillance and Metastasis via the MRTFA/KCNMB1 Axis
    Article Snippet: Chromatic immunoprecipitations (ChIP) were performed with SimpleChIP® Plus Enzymatic Chromatin IP Kit (Magnetic Beads) from Cell Signaling Technology (Cat#. 9005) as manufacturer’s instructions. .. Histone H3 (D2B12) XP Rabbit mAb (Cat#. 4620, Cell Signaling Technology), Normal Rabbit IgG (Cat#. 2729, Cell Signaling Technology), SRF (D71A9) XP Rabbit mAb (#5147, Cell Signaling Technology), and MKL1/MRTF-A (E2V2I) Rabbit mAb (Cat#. 97109, Cell signaling Technology) were used for immunoprecipitation. .. PCR was performed using KOD Hot Start DNA Polymerase (Cat#. 71316, Novagen) according to the manufacturer’s protocol with primers targeting the KCNMB1 gene; Forward: 5’ - AGACTCTGGGAAATGCAGGG – 3’, Reveres: 5’ - GGAAGCAGTCTCAGTCCCAT – 3’.



    Similar Products

    srf d71a9 xp rabbit mab  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc srf d71a9 xp rabbit mab
    Srf D71a9 Xp Rabbit Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/bio_rxiv__64898__2026__01__13__699089-207-19-25
    Average 94 stars, based on 1 article reviews
    srf d71a9 xp rabbit mab - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    srf rabbit mab d71a9  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc srf rabbit mab d71a9
    Srf Rabbit Mab D71a9, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/pmc11609158-47-86-91
    Average 94 stars, based on 1 article reviews
    srf rabbit mab d71a9 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    anti srf d71a9 xp cell signaling 5147t  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc anti srf d71a9 xp cell signaling 5147t
    Anti Srf D71a9 Xp Cell Signaling 5147t, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/pmc11067134__13058_2024_1824_MOESM6_ESM-2-131-134
    Average 94 stars, based on 1 article reviews
    anti srf d71a9 xp cell signaling 5147t - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    rabbit monoclonal anti srf d71a9  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc rabbit monoclonal anti srf d71a9

    Rabbit Monoclonal Anti Srf D71a9, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/pmc09152703-15-0-5
    Average 94 stars, based on 1 article reviews
    rabbit monoclonal anti srf d71a9 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    rabbit anti srf d71a9 xp  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc rabbit anti srf d71a9 xp

    Rabbit Anti Srf D71a9 Xp, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/bio_rxiv__2021__05__24__445473-102-18-22
    Average 94 stars, based on 1 article reviews
    rabbit anti srf d71a9 xp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    rabbit anti srf d71a9  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc rabbit anti srf d71a9

    Rabbit Anti Srf D71a9, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/bio_rxiv__2021__05__24__445473-86-57-61
    Average 94 stars, based on 1 article reviews
    rabbit anti srf d71a9 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    anti srf d71a9 xp rabbit monoclonal antibody  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc anti srf d71a9 xp rabbit monoclonal antibody

    Anti Srf D71a9 Xp Rabbit Monoclonal Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/pmc07166082-44-0-7
    Average 94 stars, based on 1 article reviews
    anti srf d71a9 xp rabbit monoclonal antibody - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    srf d71a9  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc srf d71a9

    Srf D71a9, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/bio_rxiv__787697-60-4-24
    Average 94 stars, based on 1 article reviews
    srf d71a9 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    sc 1211 srf d71a9 xp rabbit mab cell signaling technology wb  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc sc 1211 srf d71a9 xp rabbit mab cell signaling technology wb

    Sc 1211 Srf D71a9 Xp Rabbit Mab Cell Signaling Technology Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/srf+d71a9+xp+rabbit+mab/SRF+XP+Rabbit+mAb/pmc05233323__mmc1-30-258-264
    Average 94 stars, based on 1 article reviews
    sc 1211 srf d71a9 xp rabbit mab cell signaling technology wb - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Cell Reports

    Article Title: The epilepsy-associated protein PCDH19 undergoes NMDA receptor-dependent proteolytic cleavage and regulates the expression of immediate-early genes

    doi: 10.1016/j.celrep.2022.110857

    Figure Lengend Snippet:

    Article Snippet: Rabbit monoclonal anti-SRF (D71A9) , Cell Signaling Technology , Cat# 5147; RRID: AB_10694554.

    Techniques: Virus, Recombinant, shRNA, Control, Software

    Journal: Cell Reports

    Article Title: Genome-wide Screens Implicate Loss of Cullin Ring Ligase 3 in Persistent Proliferation and Genome Instability in TP53 -Deficient Cells

    doi: 10.1016/j.celrep.2020.03.029

    Figure Lengend Snippet:

    Article Snippet: Anti-SRF (D71A9) XP® Rabbit monoclonal antibody , Cell Signaling Technology , Cat#5147; RRID: AB_10694554.

    Techniques: Recombinant, Ligation, Viability Assay, Sequencing, Plasmid Preparation, Software, Infection, Transfection, Staining